Home / Products / Genome Editing / gRNA plasmids /

gRNA plasmids

gRNA Plasmids are genetic constructs designed to express guide RNAs (gRNAs) used in CRISPR-Cas9 gene editing systems. The gRNA is a crucial component in CRISPR technology, directing the Cas9 nuclease to a specific DNA sequence for targeted genome modification. gRNA Plasmids typically contain a promoter for gRNA expression and a customizable gRNA sequence that can be tailored to target a specific gene or genomic region. These plasmids are essential tools for precise genetic modifications, enabling researchers to knock out, knock in, or edit genes with high specificity and efficiency in a variety of cell types.

Get A Quote
Products Application Supporting Data Resources Related Products

Products

Catalog Number Product Name gRNA sequence Fluorescence/resistance Vector type Price
GP00001 MTX3 gRNA10 KO plasmid AGGCGGCTGGGGACTCCCAT EGFP/puro/cas9 Conventional vector $850
Gene MTX3
Gene ID 345778
specification 1ml/tube
GP00002 MARK11 gRNA5 KO plasmid CCAGTTCGGCCTACGACGCC EGFP/puro/cas9 Conventional vector $850
Gene MARK11
specification 1ml/tube
GP00003 DGKZ gRNA4 KO plasmid ACTCGCTGCACGGGGCCCCA Lentiviral vector $850
Gene DGKZ
Gene ID 8525
specification 1ml/tube
GP00004 mCcdc115 gRNA1 KO plasmid GGCGGTCCAGGCTCTGCGAG EGFP/puro Lentiviral vector $850
Gene mCcdc115
Gene ID 69668
specification 1ml/tube
GP00005 mMgll gRNA3 KO plasmid TCCTGGTAGGGAACATTCTG EGFP/Hygro Lentiviral vector $850
Gene mMgll
Gene ID 23945
specification 1ml/tube
GP00006 hUGDH gRNA2 KO plasmid ACGCCGTCCATCGAAGATAA mCherry/neo Lentiviral vector $850
Gene hUGDH
Gene ID 7358
specification 1ml/tube
GP00007 hEGLN1 gRNA2 KO plasmid GAGCCCGGCTGCGAAACCAT EGFP/Hygro Lentiviral vector $850
Gene hEGLN1
Gene ID 54583
specification 1ml/tube
GP00008 mAtf3 gRNA1 KO plasmid CCATCGGATGTCCTCTGCGC Puro Lentiviral vector $850
Gene mAtf3
Gene ID 11910
specification 1ml/tube
GP00009 hMYC gRNA1 KO plasmid GCCGTATTTCTACTGCGACG EGFP/puro Lentiviral vector $850
Gene hMYC
Gene ID 4609
specification 1ml/tube
GP00010 hMT2A gRNA1 KO plasmid CAGCCTCTTACCGGCGGCGC puro Conventional vector $850
Gene hMT2A
Gene ID 4502
specification 1ml/tube
GP00011 mSlc2a6 gRNA2 KO plasmid AAAATCCAGGCATCCTGGTT Puro Lentiviral vector $850
Gene mSlc2a6
Gene ID 227659
specification 1ml/tube
GP00012 hBCL2 gRNA3 KO plasmid CGAGTGGGATGCGGGAGATG Puro Lentiviral vector $850
Gene hBCL2
Gene ID 12043
specification 1ml/tube
GP00013 mIl17ra gRNA7-gRNA8 KO plasmid CAGGGACTAATTCTCCGTGC,CTCCTCAACAGGTACTTGTC EGFP/puro/cas9 Conventional vector $850
Gene mIl17ra
Gene ID 16172
specification 1ml/tube
GP00014 rDsp gRNA1 KO plasmidrDsp gRNA2 KO plasmidrDsp gRNA3 KO plasmid CAGCGTGTTGATCCGCGGGT GGG(99,0.67),TGTAGGTCATCTCGTAGCGC AGG(98,0.67),GGTCGTTGACAGTGCAGCGC CGG(93,0.73) EGFP/puro/cas9 Conventional vector $850
Gene rDsp
Gene ID 306871
specification 1ml/tube
GP00015 hCCDC86 gRNA1 KO plasmidhCCDC86 gRNA2 KO plasmidhCCDC86 gRNA3 KO plasmid AGCCGTCGGCTGCGCCTTAA CGG(97,0.73),CTCAGTTTCGCGGACGAGAC GGG(97,0.67),TGTCTTCGGCGGCCTTTCGG GGG(93,0.91) EGFP/puro/cas9 Conventional vector $850
Gene hCCDC86
Gene ID 79080
specification 1ml/tube
GP00016 rSenp1 gRNA1 KO plasmidrSenp1 gRNA2 KO plasmidrSenp1 gRNA3 KO plasmid AGCGTCCATCTTCACCCCGT CGG(91,0.72),GGCGGAGCTGTGGTTCACTA AGG(84,0.78),GCCACACTCAGGCTTTCCAG AGG(66,0.72) EGFP/puro/cas9 Conventional vector $850
Gene rSenp1
Gene ID 300193
specification 1ml/tube
GP00017 hHLA-C gRNA11 KO plasmid GCGACGCCGCGAGTCCAAGA EGFP/puro/cas9 Conventional vector $850
Gene hHLA-C
Gene ID 3107
specification 1ml/tube
GP00018 PIK3CA gRNA4 KO plasmid ATGATGCACGTCATGGTGGC EGFP/puro Lentiviral vector $850
Gene PIK3CA
Gene ID 5290
specification 1ml/tube
GP00019 Recql5 gRNA3-gRNA4 KO plasmid AGTAGTGAAAATCCGTTTAG,AACCCCAAAAAGATGATGAG EGFP/puro/cas9 Conventional vector $850
Gene Recql5
Gene ID 170472
specification 1ml/tube
GP00020 hSIRT6 gRNA3 KO plasmid CTTCGACCCCCCGGAGGAGC puro Lentiviral vector $850
Gene hSIRT6
Gene ID 51548
specification 1ml/tube

Application

gRNA Plasmids are extensively used in gene editing applications, where they facilitate the targeted manipulation of specific genes within the genome. In functional genomics, they are employed to create knockout models, where the gRNA directs Cas9 to cleave a specific gene, resulting in its inactivation. This allows researchers to study gene function by observing the resulting phenotypic changes. Additionally, gRNA Plasmids are used in therapeutic research to develop potential treatments for genetic disorders by correcting mutations or introducing beneficial genetic changes in disease models. They also play a critical role in high-throughput screening, where libraries of gRNA plasmids are used to systematically knock out genes across the genome to identify those involved in specific biological pathways or diseases, aiding in the discovery of new drug targets and understanding complex genetic interactions.

Supporting Data

By using the gRNA plasmid, the researchers successfully established a complete knockout line of the LmxBTN1 gene. However, the experimental results showed that even when the LmxBTN1 gene was completely knocked out, Leishmania was not significantly different from the wild-type strain in terms of in vitro growth and infectivity. This means that although the LmxBTN1 gene is upregulated at a specific pathogenic stage, it is not a gene required for parasite pathogenicity.(A Ishemgulova, et al.,2018)

Southern blot analysis of the BstE II digested L. mexicana genomic DNA of the WT, Cas9, and BTN1 ablated strains (labeled KO) with LmxM.22.0010 5’ UTR, LmxM.22.0010 3’ UTR and Puro probes.

A, Intensity of infection was assayed on days 2–3 and 7–8 p.i. and defined as weak (less than 100 promastigotes), moderate (100–1,000 promastigotes), or heavy (over 1,000 promastigotes), depending on the number of parasites per gut. Data are summarized from five independent biological replicates, numbers above each bar indicate the total number of dissected females. B, Quantitative PCR analysis of the L. mexicana load in the insect gut 7–8 days p.i. Boxplots are from five independent biological replicates and show 1st quartile, median, 3rd quartile, and 1.5× interquartile range values. C, Localization of parasites in sand fly gut 7–8 days p.i. (SV, stomodeal valve; TH,ABM, both thoracic and abdominal midgut; ABM, abdominal midgut). Numbers above each bar indicate the number of dissected females. D, Morphological analysis of Leishmania mexicana cells from thoracic midgut and stomodeal valve of infected sand fly females 7–8 days p.i. (LN, long nectomonade; SN, short nectomonade; ME, metacyclic promastigote).

Resources

Please note that all services are for research use only. Not intended for any clinical use.

Get a free quote

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.

0

There is no product in your cart.